stxbp2

Ensembl ID:
ENSDARG00000007603
ZFIN ID:
ZDB-GENE-040426-2482
Description:
syntaxin-binding protein 2 [Source:RefSeq peptide;Acc:NP_998454]
Human Orthologue:
STXBP2
Human Description:
syntaxin binding protein 2 [Source:HGNC Symbol;Acc:11445]
Mouse Orthologue:
Stxbp2
Mouse Description:
syntaxin binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:107370]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20143 Nonsense Available for shipment Available now
sa13874 Essential Splice Site Available for shipment Available now
sa2104 Essential Splice Site Available for shipment Available now
sa12115 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031234 Nonsense 267 595 10 19
Genomic Location (Zv9):
Chromosome 3 (position 53893778)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53001093
GRCz11 3 53255756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAATATTTTCTGTAATCAGTATAAATTGTCAATTACTGTCATCAGGTA[T/A]CAGACAGCAGGGATCGGTGAGGCTCGAGATAAAGAGGTGTTGCTGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031234 Essential Splice Site 302 595 10 19
Genomic Location (Zv9):
Chromosome 3 (position 53893884)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53001199
GRCz11 3 53255862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGAGCTGTGGGTTCAGCTGCGACACATGCACATAGCAGACGTCACMAAG[T/C]AAGAGCGGAGAAAGCATCAAATCTCCAGTCTGTYTGTTCTAAGTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031234 Essential Splice Site 321 595 11 19
Genomic Location (Zv9):
Chromosome 3 (position 53894023)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53001338
GRCz11 3 53256001
KASP Assay ID:
554-2872.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCTGCTGCGGGTCTTTTGTGACAGCAAGAGGATGAACACAGACAAG[G/A]TACACACTGGTGAAGACATCACACCAGTCTTGTGAAAAACACCCTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031234 Nonsense 402 595 14 19
Genomic Location (Zv9):
Chromosome 3 (position 53902485)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53009800
GRCz11 3 53264463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATGAAGAGTATCGTCCCTGTTCTTCTCAACACMGAGATCAAAGACTA[T/G]GATAAAATCCGCATCATACTGCTGTACATCTTCCACAAGAAGAAGGGTAY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link