zmynd8

Ensembl ID:
ENSDARG00000007601
ZFIN ID:
ZDB-GENE-041119-1
Human Orthologue:
ZMYND8
Human Description:
zinc finger, MYND-type containing 8 [Source:HGNC Symbol;Acc:9397]
Mouse Orthologue:
Zmynd8
Mouse Description:
zinc finger, MYND-type containing 8 Gene [Source:MGI Symbol;Acc:MGI:1918025]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2586 Nonsense Available for shipment Available now
sa11652 Nonsense Available for shipment Available now
sa41808 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38835 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040235 Nonsense 365 1201 11 20
Genomic Location (Zv9):
Chromosome 11 (position 19000594)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18417908
GRCz11 11 18580250
KASP Assay ID:
554-2519.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCCCRTTCTCTGTGAAGAAGACCAAGAGCATCTTCAACAGTGCCATG[C/T]AAGAGATGGAGGTGTACGTAGAAAACATTCGCAAAAAATTTGGWGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040235 Nonsense 932 1201 15 20
Genomic Location (Zv9):
Chromosome 11 (position 18992701)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18410015
GRCz11 11 18572357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACCAGCAGCCCCARCAGCAGGCACAGGTCTCCTCTTCCTCRTCTGGA[C/T]AGCAGGCTTCGTCCAGCACCAGATACCAAACACGACAGTCTATGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040235 Essential Splice Site 1010 1201 16 20
Genomic Location (Zv9):
Chromosome 11 (position 18989637)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18406951
GRCz11 11 18569293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCACCTCTGCAGACGTAGCGGCTGACATAGCCAAGTACACTAACAAAG[T/C]GAGATTGCTGAGGTTCATATTAACAAAAGAAGACAAAAATCATTTAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040235 Nonsense 1142 1201 19 20
Genomic Location (Zv9):
Chromosome 11 (position 18986961)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18404275
GRCz11 11 18566617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACCCCTGCCAGCAAGCACACTGGCCTGAGCACATGAAGTCCTGCACA[C/T]AGTCTGGTAAGATGTAGCAGAGGCTCAGAATCAGCACACAGTGGAGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link