
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zmynd8
- Ensembl ID:
- ENSDARG00000007601
- ZFIN ID:
- ZDB-GENE-041119-1
- Human Orthologue:
- ZMYND8
- Human Description:
- zinc finger, MYND-type containing 8 [Source:HGNC Symbol;Acc:9397]
- Mouse Orthologue:
- Zmynd8
- Mouse Description:
- zinc finger, MYND-type containing 8 Gene [Source:MGI Symbol;Acc:MGI:1918025]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2586 | Nonsense | Available for shipment | Available now |
sa11652 | Nonsense | Available for shipment | Available now |
sa41808 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38835 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa2586
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040235 | Nonsense | 365 | 1201 | 11 | 20 |
- Genomic Location (Zv9):
- Chromosome 11 (position 19000594)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 18417908 GRCz11 11 18580250 - KASP Assay ID:
- 554-2519.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGATCCCRTTCTCTGTGAAGAAGACCAAGAGCATCTTCAACAGTGCCATG[C/T]AAGAGATGGAGGTGTACGTAGAAAACATTCGCAAAAAATTTGGWGTCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11652
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040235 | Nonsense | 932 | 1201 | 15 | 20 |
- Genomic Location (Zv9):
- Chromosome 11 (position 18992701)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 18410015 GRCz11 11 18572357 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAACCAGCAGCCCCARCAGCAGGCACAGGTCTCCTCTTCCTCRTCTGGA[C/T]AGCAGGCTTCGTCCAGCACCAGATACCAAACACGACAGTCTATGAAAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41808
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040235 | Essential Splice Site | 1010 | 1201 | 16 | 20 |
- Genomic Location (Zv9):
- Chromosome 11 (position 18989637)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 18406951 GRCz11 11 18569293 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACCACCTCTGCAGACGTAGCGGCTGACATAGCCAAGTACACTAACAAAG[T/C]GAGATTGCTGAGGTTCATATTAACAAAAGAAGACAAAAATCATTTAAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38835
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040235 | Nonsense | 1142 | 1201 | 19 | 20 |
- Genomic Location (Zv9):
- Chromosome 11 (position 18986961)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 18404275 GRCz11 11 18566617 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTACCCCTGCCAGCAAGCACACTGGCCTGAGCACATGAAGTCCTGCACA[C/T]AGTCTGGTAAGATGTAGCAGAGGCTCAGAATCAGCACACAGTGGAGATCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: