zgc:63577

Ensembl ID:
ENSDARG00000007578
ZFIN ID:
ZDB-GENE-040426-1171
Description:
lipid phosphate phosphatase-related protein type 2 [Source:RefSeq peptide;Acc:NP_956750]
Human Orthologue:
AC024575.1
Human Description:
Lipid phosphate phosphatase-related protein type 2 [Source:UniProtKB/Swiss-Prot;Acc:Q96GM1]
Mouse Orthologue:
BC018242
Mouse Description:
cDNA sequence BC018242 Gene [Source:MGI Symbol;Acc:MGI:2384575]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40013 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005237 Nonsense 72 261 2 5
Genomic Location (Zv9):
Chromosome 3 (position 13738715)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14216173
GRCz11 3 14365973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGACAGGTAGTGACAGGAAACCAGACGCCTCACTTCCTGTCGGCATG[C/A]AGACCAAACTACACAGCACTGGGCTGCCATTCAAACCTCCAGTACATCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link