zcchc9

Ensembl ID:
ENSDARG00000007531
ZFIN ID:
ZDB-GENE-031030-9
Description:
zinc finger CCHC domain-containing protein 9 [Source:RefSeq peptide;Acc:NP_938184]
Human Orthologue:
ZCCHC9
Human Description:
zinc finger, CCHC domain containing 9 [Source:HGNC Symbol;Acc:25424]
Mouse Orthologue:
Zcchc9
Mouse Description:
zinc finger, CCHC domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1916335]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015872 Nonsense 130 256 3 6
Genomic Location (Zv9):
Chromosome 10 (position 44266750)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43072776
GRCz11 10 42901156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAGATCTGCTTCAACTGCCGGAAGCCTGGGCATGGACTCGCCGACTG[T/A]CCGGAAGCAAACAATGATGAAGAAATGGGCAGAGGGATCTGTTATCGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link