Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mll5
- Ensembl ID:
- ENSDARG00000007523
- ZFIN ID:
- ZDB-GENE-030131-4120
- Description:
- Myeloid/lymphoid or mixed-lineage leukemia 5 (Trithorax homolog, Drosophila)Novel protein (Zgc:64223
- Human Orthologue:
- MLL5
- Human Description:
- myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) [Source:HGNC Symbol;Acc
- Mouse Orthologue:
- Mll5
- Mouse Description:
- myeloid/lymphoid or mixed-lineage leukemia 5 Gene [Source:MGI Symbol;Acc:MGI:1924825]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa20276 | Nonsense | Available for shipment | Available now |
| sa13142 | Nonsense | Available for shipment | Available now |
| sa45175 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa20276
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000066903 | Nonsense | 89 | 334 | 4 | 9 |
| ENSDART00000123369 | Nonsense | 89 | 1265 | 4 | 21 |
| ENSDART00000126732 | Nonsense | 89 | 1375 | 3 | 23 |
| ENSDART00000130072 | Nonsense | 89 | 381 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 21381169)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 22724504 GRCz11 4 22445479 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCGCCGGCGTCCCCACCTCCCTCGGTGCTGATCCGGCCGGGCGAGAGCT[T/A]GTTTGTGTCCGGAAGCCGGCCTGGTGAGAACTTGTTTGTGCCGGGCGGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13142
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000066903 | None | 334 | None | 9 | |
| ENSDART00000123369 | Nonsense | 487 | 1265 | 11 | 21 |
| ENSDART00000126732 | Nonsense | 487 | 1375 | 10 | 23 |
| ENSDART00000130072 | None | 381 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 21374414)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 22717749 GRCz11 4 22438724 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGTGCTCAAGCAYAACCTGGAGCCCACAGAGAATCTWGGCTCTAGCACA[C/T]GACGGCGAGGCCGTAAGGACAAAGAACCATCGCGGGACGAGAGCGGACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45175
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000066903 | None | 334 | 9 | 9 | |
| ENSDART00000123369 | None | 1265 | None | 21 | |
| ENSDART00000126732 | None | 1375 | None | 23 | |
| ENSDART00000130072 | Nonsense | 364 | 381 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome 4 (position 21361273)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 22704608 GRCz11 4 22425583 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCCACACCACCGGATACTTGGGCACAGGATGGCACTGACCACACCCACC[A/T]AAACCCCGCCCTCCAGACGGACTCTCTCAGAGAGGGGGCGGAGCTACATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
