st3gal2l

Ensembl ID:
ENSDARG00000007494
ZFIN IDs:
ZDB-GENE-050417-286, ZDB-GENE-050417-286
Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 2, like [Source:RefSeq peptide;Acc:NP_001004017]
Human Orthologue:
ST3GAL2
Human Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 2 [Source:HGNC Symbol;Acc:10863]
Mouse Orthologue:
St3gal2
Mouse Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:99427]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6212 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21922 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002846 Essential Splice Site 246 341 5 7
ENSDART00000123094 Essential Splice Site 246 341 4 6
Genomic Location (Zv9):
Chromosome 11 (position 27502847)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26331673
GRCz11 11 26569289
KASP Assay ID:
554-4656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGACGTACATGAGAGTGAAAAACCGTATAGASGCTGATAAAGACAAG[G/A]TCAGTATAAATCATGCTGGATCTCGTAAATTTATAAACGAATSCACCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002846 Nonsense 324 341 7 7
ENSDART00000123094 Nonsense 324 341 6 6
Genomic Location (Zv9):
Chromosome 11 (position 27502462)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26331288
GRCz11 11 26568904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATACGCAGGTGCCTTTCGAAAAACAGGCGTTCACAATGCTGATTTC[G/T]AGACTGAGATCATTCAGAGACTCAGCGCAGAGGGCAAAATCAAGCTGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link