
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rpe65a
- Ensembl ID:
- ENSDARG00000007480
- ZFIN ID:
- ZDB-GENE-040426-1717
- Description:
- retinal pigment epithelium abundant protein RPE65 [Source:RefSeq peptide;Acc:NP_957045]
- Human Orthologue:
- RPE65
- Human Description:
- retinal pigment epithelium-specific protein 65kDa [Source:HGNC Symbol;Acc:10294]
- Mouse Orthologue:
- Rpe65
- Mouse Description:
- retinal pigment epithelium 65 Gene [Source:MGI Symbol;Acc:MGI:98001]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16919 | Nonsense | Available for shipment | Available now |
sa44520 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa30810 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16919
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004533 | Nonsense | 169 | 531 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 2 (position 2459727)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 2327379 GRCz11 2 1439797 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TWTCAATCTTTAATAACCTCCGCTTGATGACCCCTGCAGGTTGACATGTG[T/A]AATTATGTGAACATYAATGGAGTCACGGCGCATCCTCACATCGAGAGAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44520
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004533 | Essential Splice Site | 286 | 531 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 2 (position 2455117)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 2322769 GRCz11 2 1435187 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGAGGATCCAACTATATGGACTGCTTCGAGTCGGATGAAGAGAAAGGC[G/A]TAGGTTCCTCTTTATCTCACACTCGTTTTATCCGCACTATGGTGCTGCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30810
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004533 | Nonsense | 461 | 531 | 13 | 14 |
- Genomic Location (Zv9):
- Chromosome 2 (position 2450156)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 2317808 GRCz11 2 1430226 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTATAGATTTGCAAGCTGAATGTGAGGACTAAGGAGACCTGGGTATGG[C/T]AGGAGCCCGACTCGTACCCTTCGGAGCCGCTGTTTGTACAGACTCCTGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: