
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tdrd1
- Ensembl ID:
- ENSDARG00000007465
- ZFIN ID:
- ZDB-GENE-070803-1
- Description:
- Tudor domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q58EK5]
- Human Orthologue:
- TDRD1
- Human Description:
- tudor domain containing 1 [Source:HGNC Symbol;Acc:11712]
- Mouse Orthologue:
- Tdrd1
- Mouse Description:
- tudor domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1933218]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16285 | Essential Splice Site | Available for shipment | Available now |
sa42057 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa7364 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16285
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066249 | Essential Splice Site | 128 | 1176 | 4 | 25 |
- Genomic Location (Zv9):
- Chromosome 12 (position 31932350)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 30241693 GRCz11 12 30356595 - KASP Assay ID:
- 2260-5532.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGATCGCACATCGACATGTTTGCAAACCCAGCATTCCAGAAGTCACAAGG[T/A]AATATTATTTATATTCTGTTTATAACTCATTTTGAATGTTAGTTTTGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42057
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066249 | Nonsense | 668 | 1176 | 16 | 25 |
- Genomic Location (Zv9):
- Chromosome 12 (position 31928453)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 30237796 GRCz11 12 30352698 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGACGAACACACCCTGACAGAGATGTCCTTTGAGCTTATGAAACACTGT[G/T]AATCAGAGAGAGCTCCCTTTACCCCTATTGTAGGAGAACCATGTTGTGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7364
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066249 | Missense | 795 | 1176 | 18 | 25 |
- Genomic Location (Zv9):
- Chromosome 12 (position 31927361)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 30236704 GRCz11 12 30351606 - KASP Assay ID:
- 554-4074.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TRAGAAGGGTTATGGGATGGAGCTRGAAAGKGCTGGACAAACTGTTGCTT[C/T]TGTGCTCATCTCTGAGCACCTGGMTAAACCTTACGGACAGGTCAGACAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: