zgc:101606

Ensembl ID:
ENSDARG00000007430
ZFIN ID:
ZDB-GENE-041114-172
Description:
PR domain zinc finger protein 12 [Source:RefSeq peptide;Acc:NP_001007458]
Human Orthologue:
PRDM12
Human Description:
PR domain containing 12 [Source:HGNC Symbol;Acc:13997]
Mouse Orthologue:
Prdm12
Mouse Description:
PR domain containing 12 Gene [Source:MGI Symbol;Acc:MGI:2685844]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9887 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022348 Essential Splice Site 137 366 2 5
Genomic Location (Zv9):
Chromosome 5 (position 66658347)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62819339
GRCz11 5 63512730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCCGAGCATGTGGATCTCTTCAAGAACAACAATCTCATGTGGGAGG[T/C]AAGCTACGTTCAACAGGTGTCGCATGCATGGGCATGATTTTATTTTAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link