apol1

Ensembl ID:
ENSDARG00000007425
ZFIN ID:
ZDB-GENE-030131-3217
Description:
apolipoprotein L, 1 [Source:RefSeq peptide;Acc:NP_001025309]
Human Orthologues:
APOL1, APOL2, APOL3, APOL5, APOL6
Human Descriptions:
apolipoprotein L, 1 [Source:HGNC Symbol;Acc:618]
apolipoprotein L, 2 [Source:HGNC Symbol;Acc:619]
apolipoprotein L, 3 [Source:HGNC Symbol;Acc:14868]
apolipoprotein L, 5 [Source:HGNC Symbol;Acc:14869]
apolipoprotein L, 6 [Source:HGNC Symbol;Acc:14870]
Mouse Orthologues:
AL591864.1, AL592187.1, AL592187.2, Apol10a, Apol10b, Apol6, Apol7a, Apol7b, Apol7c, Apol7e, Apol8, Apol9a, Apol9b
Mouse Descriptions:
apolipoprotein L 10a Gene [Source:MGI Symbol;Acc:MGI:3036238]
apolipoprotein L 10b Gene [Source:MGI Symbol;Acc:MGI:3043522]
apolipoprotein L 11a [Source:RefSeq peptide;Acc:NP_001171004]
apolipoprotein L 11b [Source:RefSeq peptide;Acc:NP_001137158]
apolipoprotein L 6 Gene [Source:MGI Symbol;Acc:MGI:1919189]
apolipoprotein L 7a Gene [Source:MGI Symbol;Acc:MGI:1923011]
apolipoprotein L 7b Gene [Source:MGI Symbol;Acc:MGI:3583950]
apolipoprotein L 7c Gene [Source:MGI Symbol;Acc:MGI:1920912]
apolipoprotein L 7e Gene [Source:MGI Symbol;Acc:MGI:3704456]
apolipoprotein L 8 Gene [Source:MGI Symbol;Acc:MGI:2444921]
apolipoprotein L 9a Gene [Source:MGI Symbol;Acc:MGI:3606001]
apolipoprotein L 9b Gene [Source:MGI Symbol;Acc:MGI:1919148]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32975 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098547 Nonsense 198 465 10 10
Genomic Location (Zv9):
Chromosome 2 (position 37675928)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37990842
GRCz11 2 37973170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACCAGCCGCTTTTTCTCAGGGCTTTTGCTGTAACCGCTGACAAGGTG[C/T]AAAAGGGCATACGCGTGTTTAACAAACTTTTCTCAGAGCGAGCAGAAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Glomerulosclerosis: A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link