zgc:63647

Ensembl ID:
ENSDARG00000007421
ZFIN ID:
ZDB-GENE-040426-1209
Description:
formimidoyltransferase-cyclodeaminase [Source:RefSeq peptide;Acc:NP_957371]
Human Orthologue:
FTCD
Human Description:
formiminotransferase cyclodeaminase [Source:HGNC Symbol;Acc:3974]
Mouse Orthologue:
Ftcd
Mouse Description:
formiminotransferase cyclodeaminase Gene [Source:MGI Symbol;Acc:MGI:1339962]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14646 Nonsense Available for shipment Available now
sa24106 Essential Splice Site Available for shipment Available now
sa9153 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14646
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044683 Nonsense 211 550 5 14
Genomic Location (Zv9):
Chromosome 22 (position 12916929)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12752859
GRCz11 22 12777636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAYAACGTGAATCTGCTGAGCACGAAGGAACAGGCTCAMAGAATCGCAT[T/A]GGACATCAGAGAACAGGGCCGCAGTAAAGATCAAGTATGTCTTTGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044683 Essential Splice Site 491 550 12 14
Genomic Location (Zv9):
Chromosome 22 (position 12922112)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12758042
GRCz11 22 12782819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAGAGATGGTCAAATATGGAAATGTGGCATGTAAATCAGACATTCAG[G/A]TGAGAGATGTTAAACTAGACCTTTTTTTTCTAAATAAATTAATGTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044683 Nonsense 497 550 13 14
Genomic Location (Zv9):
Chromosome 22 (position 12925406)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12761336
GRCz11 22 12786113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATWTACTTGAATTCTTGACTCCTTGTATGATCAGGTAGCGGCTAAAGCTT[T/A]GGAAAYAGCAGTGTATGGAGCTTATTTCAACGTCATTATAAACCTGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link