slc2a1b

Ensembl ID:
ENSDARG00000007412
ZFIN ID:
ZDB-GENE-090915-1
Human Orthologue:
SLC2A1
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 1 [Source:HGNC Symbol;Acc:11005]
Mouse Orthologue:
Slc2a1
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7048 Nonsense Mutation detected in F1 DNA During 2018
sa20811 Essential Splice Site Available for shipment Available now
sa1752 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013872 Nonsense 51 490 2 9
ENSDART00000137458 Nonsense 13 452 1 8
Genomic Location (Zv9):
Chromosome 6 (position 48016791)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48077443
GRCz11 6 48076202
KASP Assay ID:
554-5012.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTGTGTTTCAGATCATCGAGGCCTTCTACAATGAGACGTGGACAGCT[C/T]GACACGGGGATATGAWCTCTAAAACCACAATGACTACCCTGTGGTCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013872 Essential Splice Site 227 490 4 9
ENSDART00000137458 Essential Splice Site 189 452 3 8
Genomic Location (Zv9):
Chromosome 6 (position 48015774)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48076426
GRCz11 6 48075185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCGATTTCTGCTCATTAATCGCAACGAGGAAAGCAAAGCCAAATCTGG[T/A]GAGTATGGACTCTTAGCCAGCTCTACACATCCAGATTATTATAAATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013872 Nonsense 432 490 9 9
ENSDART00000137458 Nonsense 394 452 8 8
Genomic Location (Zv9):
Chromosome 6 (position 48009536)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48070188
GRCz11 6 48068947
KASP Assay ID:
554-1745.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATATTTCCTCTTTGTCCATRTGTTGAACAGGAGGTCTGTGGGGCGTA[C/A]GTGTTTGTCATCTTCACCGTGTTCTTACTCTGCTTCTTCATCTTCACCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link