
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dmrt1
- Ensembl ID:
- ENSDARG00000007349
- ZFIN ID:
- ZDB-GENE-050511-1
- Description:
- doublesex- and mab-3-related transcription factor 1 isoform 1 [Source:RefSeq peptide;Acc:NP_991191]
- Human Orthologue:
- DMRT1
- Human Description:
- doublesex and mab-3 related transcription factor 1 [Source:HGNC Symbol;Acc:2934]
- Mouse Orthologue:
- Dmrt1
- Mouse Description:
- doublesex and mab-3 related transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1354733]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31472 | Nonsense | Available for shipment | Available now |
sa26559 | Essential Splice Site, Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31472
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000044361 | Nonsense | 48 | 267 | 1 | 5 |
ENSDART00000124637 | Nonsense | 48 | 268 | 1 | 5 |
ENSDART00000126066 | Nonsense | 48 | 256 | 1 | 5 |
ENSDART00000128825 | Nonsense | 48 | 191 | 1 | 4 |
ENSDART00000130428 | Nonsense | 48 | 190 | 1 | 4 |
The following transcripts of ENSDARG00000007349 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 46563669)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 44344934 GRCz11 5 44945087 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCACCGCTGAAGGGCCACAAACGCTTCTGTAATTGGAGAGACTGCCAGTG[T/A]CAGAAATGCAGACTCATCGCCGAGAGACAGCGGGTCATGGCTGCCCAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26559
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site, Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000044361 | Splice Site | None | 267 | None | 5 |
ENSDART00000124637 | Essential Splice Site | 224 | 268 | None | 5 |
ENSDART00000126066 | None | 256 | None | 5 | |
ENSDART00000128825 | Essential Splice Site | 177 | 191 | None | 4 |
ENSDART00000130428 | Splice Site | None | 190 | None | 4 |
The following transcripts of ENSDARG00000007349 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 46608090)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 44389355 GRCz11 5 44989508 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCGCCAATAATAAACACCAAATAGTTCATGTTTCATGATCCATCCCAT[T/A]TCAGCTTTCTCCGATGGAGCTCAAGACTCTGTGTCCATCAGCTCGATGAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Testicular cancer: A second independent locus within DMRT1 is associated with testicular germ cell tumor susceptibility. (View Study)
- Testicular germ cell cancer: Variants near DMRT1, TERT and ATF7IP are associated with testicular germ cell cancer. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: