yipf5

Ensembl ID:
ENSDARG00000007279
ZFIN ID:
ZDB-GENE-040426-1057
Description:
Protein YIPF5 [Source:UniProtKB/Swiss-Prot;Acc:Q6P5I8]
Human Orthologue:
YIPF5
Human Description:
Yip1 domain family, member 5 [Source:HGNC Symbol;Acc:24877]
Mouse Orthologue:
Yipf5
Mouse Description:
Yip1 domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1914430]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37374 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008593 Essential Splice Site 95 257 4 6
Genomic Location (Zv9):
Chromosome 21 (position 39581454)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40909916
GRCz11 21 40932963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAACAATCCTGTAAAATTATAAAAAATATATTTCTTTTTTTCATTTTC[A/T]GAACTGGGAATTAACTTTGACCACATCTGGCAGAAAACGCTGACTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link