si:ch211-251b21.1

Ensembl ID:
ENSDARG00000007275
ZFIN ID:
ZDB-GENE-060809-5
Description:
si:ch211-251b21.1 [Source:RefSeq peptide;Acc:NP_001138274]
Human Orthologues:
GRID1, GRID2, GRIN3A, GRIN3B
Human Descriptions:
glutamate receptor, ionotropic, delta 1 [Source:HGNC Symbol;Acc:4575]
glutamate receptor, ionotropic, delta 2 [Source:HGNC Symbol;Acc:4576]
glutamate receptor, ionotropic, N-methyl-D-aspartate 3A [Source:HGNC Symbol;Acc:16767]
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B [Source:HGNC Symbol;Acc:16768]
Mouse Orthologues:
Grid1, Grid2, Grin3a, Grin3b
Mouse Descriptions:
glutamate receptor ionotropic, NMDA3A Gene [Source:MGI Symbol;Acc:MGI:1933206]
glutamate receptor, ionotropic, delta 1 Gene [Source:MGI Symbol;Acc:MGI:95812]
glutamate receptor, ionotropic, delta 2 Gene [Source:MGI Symbol;Acc:MGI:95813]
glutamate receptor, ionotropic, NMDA3B Gene [Source:MGI Symbol;Acc:MGI:2150393]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45338 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008778 Nonsense 175 458 5 9
ENSDART00000139096 Nonsense 175 458 6 10
Genomic Location (Zv9):
Chromosome 8 (position 49810621)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47662598
GRCz11 8 47651590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCATGACTTAAGTTCTGTTTTCCAGGATCAGCCCCTGTGAGTGGGAG[C/T]AACCAGAGAAAGACAACAATTCCTTCACGCTCTCACACAGTTTTTGGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link