wdr55

Ensembl ID:
ENSDARG00000007217
ZFIN ID:
ZDB-GENE-040924-7
Description:
WD repeat-containing protein 55 [Source:UniProtKB/Swiss-Prot;Acc:Q6DRF9]
Human Orthologue:
WDR55
Human Description:
WD repeat domain 55 [Source:HGNC Symbol;Acc:25971]
Mouse Orthologue:
Wdr55
Mouse Description:
WD repeat domain 55 Gene [Source:MGI Symbol;Acc:MGI:1915186]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23995 Splice Site, Nonsense Available for shipment Available now
sa15825 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003962 Splice Site, Nonsense 13 386 1 8
Genomic Location (Zv9):
Chromosome 21 (position 33780795)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34780488
GRCz11 21 34814978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTACAACAAACATGGCGACTCCCACAGAACACGAGGATTTATCTGAA[C/T]AAGTAAGTTTTTGTGTTGTTTTACGATGTCAAACGTTGCAGGAATGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003962 Essential Splice Site 61 386 2 8
Genomic Location (Zv9):
Chromosome 21 (position 33781154)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34780847
GRCz11 21 34815337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACAAGACATTCTTGCAGCAGGAGACATTGATGGCGATATTTACCTG[T/A]GAGTTTGTTTTCTAAAGGCGTCTAAAGTCCTTGTWCARTTGGCAGAARTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link