wu:fb54a03

Ensembl ID:
ENSDARG00000007204
ZFIN ID:
ZDB-GENE-030131-954
Description:
Wu:fb54a03 protein [Source:UniProtKB/TrEMBL;Acc:A7E282]
Human Orthologue:
ZRANB2
Human Description:
zinc finger, RAN-binding domain containing 2 [Source:HGNC Symbol;Acc:13058]
Mouse Orthologue:
Zranb2
Mouse Description:
zinc finger, RAN-binding domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1858211]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42922 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064993 Nonsense 125 715 3 8
Genomic Location (Zv9):
Chromosome 17 (position 23054337)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23204486
GRCz11 17 23224510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTACATTTCTTTGTGCTTCTAAATAGAAAAAAGGCAGAGGAGTTTCTC[C/T]GAATCCTGGGGGCAAGTGACCGTATTGAGCCAGCAGGAGATAAAAATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link