si:dkey-264g21.1

Ensembl ID:
ENSDARG00000007179
ZFIN ID:
ZDB-GENE-030131-9960
Description:
SAM and SH3 domain containing 1 [Source:RefSeq peptide;Acc:NP_001038284]
Human Orthologue:
SASH1
Human Description:
SAM and SH3 domain containing 1 [Source:HGNC Symbol;Acc:19182]
Mouse Orthologue:
Sash1
Mouse Description:
SAM and SH3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917347]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43478 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10306 Nonsense Available for shipment Available now
sa11349 Nonsense Available for shipment Available now
sa37072 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43477 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046841 Essential Splice Site 152 1192 6 20

The following transcripts of ENSDARG00000007179 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 31486818)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31558031
GRCz11 20 31460910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAACTTCCGAAAGTCACAGAAGGGGGTCACAAGGCAAGCGTCAAAAG[G/A]TAATAAAAACAAACTCACTGCATTTTTCTCATGTTACATCCCTTCATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046841 Nonsense 296 1192 10 20

The following transcripts of ENSDARG00000007179 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 31477653)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31548866
GRCz11 20 31451745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGATATAAATGCACTATATGCAGAAATCCACAAGAAGCCGGCAAAGTG[T/A]ACAGACTCCTCTTTGYCCTCAYTTGCCCAAGAGCAGCTTTCTCTGGAYGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046841 Nonsense 880 1192 18 20

The following transcripts of ENSDARG00000007179 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 31462468)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31533681
GRCz11 20 31436560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGGAGAGCWGCACAAAAGAAATGAAAGCAGAWCTTGTAGACTCCAAA[C/T]AGGATGAGAAGACCAATATGGCTAAAAGGCAGACTGGCTCYTTGCAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046841 Essential Splice Site 1062 1192 18 20

The following transcripts of ENSDARG00000007179 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 31461918)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31533131
GRCz11 20 31436010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCACTCGGAAGGGATCGACCTCAAAGAGGAGCCTTACTCTGATAAAG[T/C]AAGTCTTTGTTTCACTTTGAATAAGTATTAATGAAGGCTGTTGCCATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046841 Nonsense 1098 1192 19 20

The following transcripts of ENSDARG00000007179 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 31458655)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31529868
GRCz11 20 31432747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCCAGCGAAGGACGTGGCGTCCAGTCTTGATCAAATCAGAGTTAAA[C/T]AACTCCGCAAGGAGCACCGCATGGCTGTGAGTTATAGATTCATTCATTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link