zgc:110692

Ensembl ID:
ENSDARG00000007173
ZFIN ID:
ZDB-GENE-050522-490
Description:
cytochrome P450 [Source:RefSeq peptide;Acc:NP_001018658]
Human Orthologues:
CYP2F1, CYP2S1
Human Descriptions:
cytochrome P450, family 2, subfamily F, polypeptide 1 [Source:HGNC Symbol;Acc:2632]
cytochrome P450, family 2, subfamily S, polypeptide 1 [Source:HGNC Symbol;Acc:15654]
Mouse Orthologues:
Cyp2f2, Cyp2s1, Cyp2t4
Mouse Descriptions:
cytochrome P450, family 2, subfamily f, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:88608]
cytochrome P450, family 2, subfamily s, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1921384]
cytochrome P450, family 2, subfamily t, polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:2686296]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa815 Nonsense Available for shipment Available now
sa2784 Nonsense F2 line generated During 2018
sa42457 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002842 Nonsense 141 491 3 9
Genomic Location (Zv9):
Chromosome 15 (position 69311)
KASP Assay ID:
554-0719.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGCGGTTCACGCTCACCACACTGAGGGATTTTGGAATGGGACGCAAA[C/T]AAATGGAGCAATGGATTCAAGAAGAGAGCAGATACTTGCTCAAGAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2784
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002842 Nonsense 215 491 4 9
Genomic Location (Zv9):
Chromosome 15 (position 68982)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 101900
GRCz11 15 29709
KASP Assay ID:
554-2482.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCAGATCATCTCCAAACTACTGCGATTTTTAAGCAGCCCTTGGGGA[C/T]AGGTGAGACCGTGTAACTGYTTGTAACTATGTTTGTRTGCTTTCAACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002842 Nonsense 370 491 7 9
Genomic Location (Zv9):
Chromosome 15 (position 66804)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 99939
GRCz11 15 27748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAGTGCAGCGCTATATGGACATTGTGCCTCTAAGTCTTCCCCACTA[T/A]GCCATGAAAGACATCACTTTCAGAGGCTATAAAATCCCCAAGGTAACGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link