zgc:123268

Ensembl ID:
ENSDARG00000007151
ZFIN ID:
ZDB-GENE-051120-69
Description:
hypothetical protein LOC568565 [Source:RefSeq peptide;Acc:NP_001032475]
Human Orthologue:
KCNK2
Human Description:
potassium channel, subfamily K, member 2 [Source:HGNC Symbol;Acc:6277]
Mouse Orthologue:
Kcnk2
Mouse Description:
potassium channel, subfamily K, member 2 Gene [Source:MGI Symbol;Acc:MGI:109366]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8664 Nonsense Mutation detected in F1 DNA During 2018
sa39264 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046438 Nonsense 308 384 7 7
ENSDART00000127625 Nonsense 349 425 7 7
ENSDART00000144992 Nonsense 343 418 6 6
Genomic Location (Zv9):
Chromosome 20 (position 622127)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 615402
GRCz11 20 605249
KASP Assay ID:
2261-3821.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCCRCTGAGTTTAAAGAGACACGTCGTCGACTGAGTGTCGACATTTA[T/A]GACAAATTCCAGCGYGCAACTTCAGTAAAACGCAAACTGTCYGCGGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046438 Nonsense 334 384 7 7
ENSDART00000127625 Nonsense 375 425 7 7
ENSDART00000144992 Nonsense 369 418 6 6
Genomic Location (Zv9):
Chromosome 20 (position 622203)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 615478
GRCz11 20 605325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAACGCAAACTGTCCGCGGAAATAAATCTCAGCCCTCCTATCAATCAG[C/T]AGATGACCCCAGGGAAGCGTGCACGTTCGGTTAACCTTGGAGACGAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link