si:dkey-29b22.6

Ensembl ID:
ENSDARG00000007129
ZFIN ID:
ZDB-GENE-061009-43
Description:
Transporter [Source:UniProtKB/TrEMBL;Acc:A3QK28]
Human Orthologues:
SLC6A15, SLC6A17
Human Descriptions:
solute carrier family 6 (neutral amino acid transporter), member 15 [Source:HGNC Symbol;Acc:13621]
solute carrier family 6, member 17 [Source:HGNC Symbol;Acc:31399]
Mouse Orthologues:
Slc6a15, Slc6a17
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter), member 15 Gene [Source:MGI Symbol;Acc:MGI:21
solute carrier family 6 (neurotransmitter transporter), member 17 Gene [Source:MGI Symbol;Acc:MGI:24

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31315 Essential Splice Site Available for shipment Available now
sa18748 Nonsense Mutation detected in F1 DNA During 2018
sa33124 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080771 Essential Splice Site 130 693 None 11
ENSDART00000132869 Essential Splice Site 133 587 None 10

The following transcripts of ENSDARG00000007129 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 16189489)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16419708
GRCz11 3 16569508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACACATATCACCTCGTCTCGCCGGCATCGGTTACTCCAGCTGCATGG[T/C]AAAACAAACATGTTCATAAACTCTACATGAGTATAACATATGGTTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080771 Nonsense 524 693 9 11
ENSDART00000132869 Nonsense 527 587 9 10

The following transcripts of ENSDARG00000007129 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 16208562)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16438781
GRCz11 3 16588581
KASP Assay ID:
2259-3209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGCTGCCACTGATCATTGTTGTCATTTTTGAGACCGTCAGCGTGGCGT[G/A]GATTTACGGTGCAGATCGGTGAGGAATCTTTGTTTTATATGCTGATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080771 Nonsense 682 693 11 11
ENSDART00000132869   None 587 None 10

The following transcripts of ENSDARG00000007129 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 16211591)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16441810
GRCz11 3 16591610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCGCCTTCCTGACACTGGCTCCCGAACACTACAGGCTGCTCTCGCAA[C/T]AGGAGGATGGAGAGGAAGAGGAAGACACTGGGGTTTAGGGAAATACTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link