zgc:110231

Ensembl ID:
ENSDARG00000007125
ZFIN ID:
ZDB-GENE-050522-338
Description:
ankyrin repeat and SOCS box protein 6 [Source:RefSeq peptide;Acc:NP_001018412]
Human Orthologue:
ASB6
Human Description:
ankyrin repeat and SOCS box-containing 6 [Source:HGNC Symbol;Acc:17181]
Mouse Orthologue:
Asb6
Mouse Description:
ankyrin repeat and SOCS box-containing 6 Gene [Source:MGI Symbol;Acc:MGI:1919573]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38665 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014915 Nonsense 113 435 5 8
ENSDART00000117148 Nonsense 113 435 3 6
ENSDART00000138259 Nonsense 113 274 4 7
ENSDART00000142496 Nonsense 113 256 5 8
Genomic Location (Zv9):
Chromosome 8 (position 7480025)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6866828
GRCz11 8 6910376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACAACCCTTTACACATCGCAGTACTGAGAAACAAACCAGACATGGTG[C/T]GAATGTTGATCTCGAGTGGAGCTGATATTGACAAAAGAGACAGGGTGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link