
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-145p14.5
- Ensembl ID:
- ENSDARG00000007077
- ZFIN ID:
- ZDB-GENE-041008-117
- Description:
- Si:dkey-145p14.5 protein [Source:UniProtKB/TrEMBL;Acc:Q5BJ03]
- Human Orthologue:
- ANKRD50
- Human Description:
- ankyrin repeat domain 50 [Source:HGNC Symbol;Acc:29223]
- Mouse Orthologues:
- Ankrd50, E230028L10Rik
- Mouse Descriptions:
- ankyrin repeat domain 50 Gene [Source:MGI Symbol;Acc:MGI:2139777]
- RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21520 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21520
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020798 | Nonsense | 239 | 537 | 1 | 2 |
ENSDART00000121751 | None | 322 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 33906712)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 33062658 GRCz11 9 32873404 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAAACAAAGTCATTTCACAATTGTCAGACTTCTGGAGAGCTATGGCGCC[A/T]AACCCTTCTCAGGTTTAATACCATTCACACCTAGTGGTGCTCCTAATGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: