si:dkey-230e6.2

Ensembl ID:
ENSDARG00000007045
ZFIN ID:
ZDB-GENE-090313-262
Human Orthologue:
CNOT4
Human Description:
CCR4-NOT transcription complex, subunit 4 [Source:HGNC Symbol;Acc:7880]
Mouse Orthologue:
Cnot4
Mouse Description:
CCR4-NOT transcription complex, subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1859026]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44291 Nonsense Mutation detected in F1 DNA During 2018
sa13605 Essential Splice Site Available for shipment Available now
sa39482 Nonsense Mutation detected in F1 DNA During 2018
sa44290 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034714 Nonsense 131 772 3 12
ENSDART00000140182   None 31 None 2
Genomic Location (Zv9):
Chromosome 25 (position 20506491)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19917392
GRCz11 25 20015046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTCTCTCTCTTAATCGTTTCTTAGGTTCTAAAGCGTCCAGAGTA[T/A]TTTGGCAAGTTTGGAAAAATTCATAAAGTGGTCATCAATAACAGCACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034714 Essential Splice Site 187 772 4 12
ENSDART00000140182   None 31 None 2
Genomic Location (Zv9):
Chromosome 25 (position 20505227)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19916128
GRCz11 25 20013782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGYAATACAATGTGTAAACAATGTCATAGTGGACGGTAGAACGCTCAAG[G/A]TAAGTGCTAAGYCATCAGAATTTGATCTGTTTACAYARTATTTTCACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034714 Nonsense 227 772 5 12
ENSDART00000140182   None 31 None 2
Genomic Location (Zv9):
Chromosome 25 (position 20503894)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19914795
GRCz11 25 20012449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGTATTTACATGAACTTGGCGATGAGGCAGCTAGTTTTACAAAAGAA[G/T]AAATGCAGGTGAGGGTGCATGTTTACACCTGATAACTTCAAAGCAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034714 Nonsense 229 772 5 12
ENSDART00000140182   None 31 None 2
Genomic Location (Zv9):
Chromosome 25 (position 20503888)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19914789
GRCz11 25 20012443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACATGAACTTGGCGATGAGGCAGCTAGTTTTACAAAAGAAGAAATG[C/T]AGGTGAGGGTGCATGTTTACACCTGATAACTTCAAAGCAGAAATTGAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link