
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-230e6.2
- Ensembl ID:
- ENSDARG00000007045
- ZFIN ID:
- ZDB-GENE-090313-262
- Human Orthologue:
- CNOT4
- Human Description:
- CCR4-NOT transcription complex, subunit 4 [Source:HGNC Symbol;Acc:7880]
- Mouse Orthologue:
- Cnot4
- Mouse Description:
- CCR4-NOT transcription complex, subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1859026]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44291 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa13605 | Essential Splice Site | Available for shipment | Available now |
sa39482 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44290 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44291
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000034714 | Nonsense | 131 | 772 | 3 | 12 |
ENSDART00000140182 | None | 31 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20506491)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19917392 GRCz11 25 20015046 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTCTCTCTCTCTCTTAATCGTTTCTTAGGTTCTAAAGCGTCCAGAGTA[T/A]TTTGGCAAGTTTGGAAAAATTCATAAAGTGGTCATCAATAACAGCACGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13605
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000034714 | Essential Splice Site | 187 | 772 | 4 | 12 |
ENSDART00000140182 | None | 31 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20505227)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19916128 GRCz11 25 20013782 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGYAATACAATGTGTAAACAATGTCATAGTGGACGGTAGAACGCTCAAG[G/A]TAAGTGCTAAGYCATCAGAATTTGATCTGTTTACAYARTATTTTCACGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39482
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000034714 | Nonsense | 227 | 772 | 5 | 12 |
ENSDART00000140182 | None | 31 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20503894)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19914795 GRCz11 25 20012449 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATGTATTTACATGAACTTGGCGATGAGGCAGCTAGTTTTACAAAAGAA[G/T]AAATGCAGGTGAGGGTGCATGTTTACACCTGATAACTTCAAAGCAGAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44290
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000034714 | Nonsense | 229 | 772 | 5 | 12 |
ENSDART00000140182 | None | 31 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20503888)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19914789 GRCz11 25 20012443 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTACATGAACTTGGCGATGAGGCAGCTAGTTTTACAAAAGAAGAAATG[C/T]AGGTGAGGGTGCATGTTTACACCTGATAACTTCAAAGCAGAAATTGAATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: