
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ms4a17a.6
- Ensembl ID:
- ENSDARG00000007018
- ZFIN IDs:
- ZDB-GENE-070209-265, ZDB-GENE-070209-265
- Description:
- membrane-spanning 4-domains, subfamily A, member 17A.6 [Source:RefSeq peptide;Acc:NP_001076481]
- Human Orthologues:
- MS4A12, MS4A15, MS4A2, MS4A3, MS4A4A, MS4A8B, RP11-312N17.2
- Human Descriptions:
- Membrane-spanning 4-domains subfamily A member 18 [Source:UniProtKB/Swiss-Prot;Acc:Q3C1V0]
- membrane-spanning 4-domains, subfamily A, member 12 [Source:HGNC Symbol;Acc:13370]
- membrane-spanning 4-domains, subfamily A, member 15 [Source:HGNC Symbol;Acc:28573]
- membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor fo
- membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) [Source:HGNC Symbol
- membrane-spanning 4-domains, subfamily A, member 4 [Source:HGNC Symbol;Acc:13371]
- membrane-spanning 4-domains, subfamily A, member 8B [Source:HGNC Symbol;Acc:13380]
- Mouse Orthologues:
- AC134839.1, Ms4a15, Ms4a2, Ms4a3, Ms4a4b, Ms4a4c, Ms4a4d, Ms4a8a
- Mouse Descriptions:
- membrane-spanning 4-domains, subfamily A, member 15 Gene [Source:MGI Symbol;Acc:MGI:3617853]
- membrane-spanning 4-domains, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:95495]
- membrane-spanning 4-domains, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2158468]
- membrane-spanning 4-domains, subfamily A, member 4B Gene [Source:MGI Symbol;Acc:MGI:1913083]
- membrane-spanning 4-domains, subfamily A, member 4C Gene [Source:MGI Symbol;Acc:MGI:1927656]
- membrane-spanning 4-domains, subfamily A, member 4D Gene [Source:MGI Symbol;Acc:MGI:1913857]
- membrane-spanning 4-domains, subfamily A, member 8A Gene [Source:MGI Symbol;Acc:MGI:1927657]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa26361 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa26361
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075602 | Nonsense | 108 | 241 | 4 | 7 |
ENSDART00000075605 | Nonsense | 108 | 241 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 4 (position 60779377)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 75160502 GRCz11 4 76737240 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCTCGCTCTCCATTGCTGCTGAAACCAAAATTAATTCACCAGCCGGTT[T/A]ATGTCTGGTATGTACACAACACTTGTTCTTTTCATGGGTCTAAACACTGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Alzheimer's disease (late onset): Common variants at MS4A4/MS4A6E, CD2AP, CD33 and EPHA1 are associated with late-onset Alzheimer's disease. (View Study)
- Vitamin B12 levels: Genome-wide association study identifies novel loci associated with serum level of vitamin B12 in Chinese men. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: