tbx6

Ensembl ID:
ENSDARG00000006939
ZFIN ID:
ZDB-GENE-980526-171
Description:
T-box transcription factor TBX6 [Source:UniProtKB/Swiss-Prot;Acc:P79742]
Human Orthologues:
TBX2, TBX3
Human Descriptions:
T-box 2 [Source:HGNC Symbol;Acc:11597]
T-box 3 [Source:HGNC Symbol;Acc:11602]
Mouse Orthologues:
Tbx2, Tbx3
Mouse Descriptions:
T-box 2 Gene [Source:MGI Symbol;Acc:MGI:98494]
T-box 3 Gene [Source:MGI Symbol;Acc:MGI:98495]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31470 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022492 Essential Splice Site 95 473 3 9
ENSDART00000142855 Essential Splice Site 110 488 3 9
Genomic Location (Zv9):
Chromosome 5 (position 43900997)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41682262
GRCz11 5 42282415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGTGGTGATAATGGACATGGTGCCGTTTGATAACCACAAGTACAAG[G/T]TACCTCCCCTCCACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link