wnt8b

Ensembl ID:
ENSDARG00000006911
ZFIN ID:
ZDB-GENE-990415-279
Description:
Protein Wnt-8b [Source:UniProtKB/Swiss-Prot;Acc:P51029]
Human Orthologue:
WNT8B
Human Description:
wingless-type MMTV integration site family, member 8B [Source:HGNC Symbol;Acc:12789]
Mouse Orthologue:
Wnt8b
Mouse Description:
wingless related MMTV integration site 8b Gene [Source:MGI Symbol;Acc:MGI:109485]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17566 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049624 Nonsense 250 358 6 6
Genomic Location (Zv9):
Chromosome 13 (position 30217583)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29863531
GRCz11 13 29993981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCATTGCTGAAACCTTCAACTCCATTTCACGGAAAGAGCTGGTGCATT[T/A]GGAGGATTCTCCAGACTACTGCTTGGAGAACCGCACTCTAGGCTTGCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link