si:dkey-249g23.1

Ensembl ID:
ENSDARG00000006892
ZFIN IDs:
ZDB-GENE-070706-2, ZDB-GENE-070912-471
Description:
Novel protein similar to H.sapiens MYO3B, myosin IIIB (MYO3B) [Source:UniProtKB/TrEMBL;Acc:B0S5S5]
Human Orthologues:
MYO9A, MYO9B
Human Descriptions:
myosin IXA [Source:HGNC Symbol;Acc:7608]
myosin IXB [Source:HGNC Symbol;Acc:7609]
Mouse Orthologues:
Myo9a, Myo9b
Mouse Descriptions:
myosin IXa Gene [Source:MGI Symbol;Acc:MGI:107735]
myosin IXb Gene [Source:MGI Symbol;Acc:MGI:106624]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27329 Nonsense Mutation detected in F1 DNA During 2018
sa7171 Nonsense Mutation detected in F1 DNA During 2018
sa34546 Nonsense Mutation detected in F1 DNA During 2018
sa15983 Nonsense Available for shipment Available now
sa41340 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 220 1124 6 27
ENSDART00000141492   None 889 None 22
Genomic Location (Zv9):
Chromosome 9 (position 3864646)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3881025
GRCz11 9 3852554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGTGAACAGCAGTATGACTACTCGTATGACGCCCGCTGTGATGTGTG[G/A]TCGCTGGGCATCACTGCTATAGAGCTGGCAGACGGAGACCCACCACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 509 1124 13 27
ENSDART00000141492 Nonsense 260 889 7 22
Genomic Location (Zv9):
Chromosome 9 (position 3811677)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3843698
GRCz11 9 3815227
KASP Assay ID:
554-5269.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGATGAAGTTTACTCCTACAGGAGCAGTGATGGGTGCCAAGATCTCA[G/T]AGTAWCTTCTGGAGAAATCRAGAGTCATCAAACAGGCTACGTGAGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 804 1124 19 27
ENSDART00000141492 Nonsense 554 889 13 22
Genomic Location (Zv9):
Chromosome 9 (position 3795994)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3828015
GRCz11 9 3799544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTACTGTCTTTACTGGATGAGGAGAGCCGATTCCCACAGGCCACTGAC[C/T]AAACTCTTGTCGGTAATGAGCAATTCCATGCAAATGTCAACCTTGCCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 870 1124 21 27
ENSDART00000141492 Nonsense 620 889 15 22
Genomic Location (Zv9):
Chromosome 9 (position 3792000)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3824021
GRCz11 9 3795550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGCAGACATCGTGGTGGTTTTGAGGACATCKGAGAACAGACTTCTG[C/T]WGCAGCTGWTTTCCAGCCCTCTGACAAAARCAGGTACCAGAGTCATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Essential Splice Site 908 1124 23 27
ENSDART00000141492 Essential Splice Site 658 889 17 22
Genomic Location (Zv9):
Chromosome 9 (position 3767095)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3799116
GRCz11 9 3770645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATTGGCGGTGCAGAAACGCTACAGTAAGTGTGTTTGTGTGTGTTTA[G/A]GTGGACACCATGGAAATGATGCGTCACCCTGAAGAAACCACTAACATGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link