si:dkey-23n7.9

Ensembl ID:
ENSDARG00000006878
ZFIN ID:
ZDB-GENE-050208-99
Description:
Si:dkey-23n7.9 protein [Source:UniProtKB/TrEMBL;Acc:Q5BJ12]
Human Orthologue:
PHF21A
Human Description:
PHD finger protein 21A [Source:HGNC Symbol;Acc:24156]
Mouse Orthologue:
Phf21a
Mouse Description:
PHD finger protein 21A Gene [Source:MGI Symbol;Acc:MGI:2384756]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2379 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa2379
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037361 Essential Splice Site 364 607 11 15
ENSDART00000142859   None 142 None 7

The following transcripts of ENSDARG00000006878 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 40227851)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38564491
GRCz11 7 38835749
KASP Assay ID:
554-3206.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAACTGATTGAAGAAATCGGATGGAATGAACCATGCGTGTGTTTTTC[A/T]GAGGAAGAAGAGCTCTGTGTCTTATCTGAGTTCCATAAACCAGTCCAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link