zgc:65908

Ensembl ID:
ENSDARG00000006859
ZFIN ID:
ZDB-GENE-040426-1472
Description:
Sodium/potassium-transporting ATPase subunit beta-1-interacting protein 1 [Source:UniProtKB/Swiss-Pr
Human Orthologue:
NKAIN1
Human Description:
Na+/K+ transporting ATPase interacting 1 [Source:HGNC Symbol;Acc:25743]
Mouse Orthologue:
Nkain1
Mouse Description:
Na+/K+ transporting ATPase interacting 1 Gene [Source:MGI Symbol;Acc:MGI:1914399]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15279 Nonsense Available for shipment Available now
sa15258 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015632 Nonsense 138 207 5 8
ENSDART00000132213 Nonsense 138 154 4 4
Genomic Location (Zv9):
Chromosome 19 (position 44629680)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43457348
GRCz11 19 43026785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCGCYATTGGCTCCTCAGGATCATCATGTGATCACTGTCAGCGGCTG[C/A]TTGCTGGACTACCAGTACATAGAGGTGGTCAGTTCAGCTCTGCAAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015632 Essential Splice Site 157 207 5 8
ENSDART00000132213   None 154 None 4
Genomic Location (Zv9):
Chromosome 19 (position 44629739)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43457407
GRCz11 19 43026844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACCAGTACATAGAGGTGGTCAGTTCAGCTCTGCAAGTGTTTCTCGCAG[T/G]GAGTCTTTTACCTTCAATCTATTGCTTCGGTCACATCTCAGTCTGAGRAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Alcohol dependence: NKAIN1-SERINC2 is a functional, replicable and genome-wide significant risk gene region specific for alcohol dependence in subjects of European descent. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link