
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-219a4.6
- Ensembl ID:
- ENSDARG00000006848
- ZFIN ID:
- ZDB-GENE-081104-179
- Description:
- Novel protein similar to vertebrate poly (ADP-ribose) polymerase family [Source:UniProtKB/TrEMBL;Acc
- Human Orthologue:
- PARP9
- Human Description:
- poly (ADP-ribose) polymerase family, member 9 [Source:HGNC Symbol;Acc:24118]
- Mouse Orthologues:
- Parp9, Zc3hav1
- Mouse Descriptions:
- poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI Symbol;Acc:MGI:1933117]
- zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21485 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21485
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027212 | Essential Splice Site | 446 | 456 | 5 | 6 |
ENSDART00000090486 | Essential Splice Site | 446 | 840 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 9 (position 24793674)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 23949460 GRCz11 9 23760329 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTGGATGTATACTTTGTTGTTTTTCCAAAAGACAATGACATGATGAAG[G/A]TGATTTGCTTATTATACTGGCTTTTTGGTGCCCAACATTCATTTTCTATT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: A mega-analysis of genome-wide association studies for major depressive disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: