
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:92085
- Ensembl ID:
- ENSDARG00000006838
- ZFIN ID:
- ZDB-GENE-040718-64
- Description:
- elongation factor 1-alpha 2 [Source:RefSeq peptide;Acc:NP_001002371]
- Human Orthologue:
- EEF1A2
- Human Description:
- eukaryotic translation elongation factor 1 alpha 2 [Source:HGNC Symbol;Acc:3192]
- Mouse Orthologue:
- Eef1a2
- Mouse Description:
- eukaryotic translation elongation factor 1 alpha 2 Gene [Source:MGI Symbol;Acc:MGI:1096317]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37650 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa39401 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa12662 | Nonsense | Available for shipment | Available now |
sa3224 | Nonsense | F2 line generated | During 2018 |
sa13094 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37650
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010119 | Nonsense | 196 | 463 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 16064682)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 16105219 GRCz11 23 15861296 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGATTGGTTATAGTCCAGCTTCCGTACCCTTTGTCCCTATTTCAGGCTG[G/A]CATGGCGACAACATGCTGGAACCGTCTTCCAATGTGAGTCTCCTTGGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39401
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010119 | Essential Splice Site | 257 | 463 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 16064375)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 16104912 GRCz11 23 15860989 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTGATAAACCCTTACGTCTTCCACTACAAGATGTCTACAAGATTGGAG[G/A]TGAGATCTAATGTTATTTAAAGAATTAGTTCACCCAAAATTTGTTAATAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12662
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 16057497)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 16098034 GRCz11 23 15854111 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTATGTTTTTTTTTTTGTTATCAGGTCATCATTTTGAATCACCCAGGA[C/T]AGATCAGTTCAGGTTACTCTCCTGTCATAGACTGTCACACTGCTCATATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa3224
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 16057497)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 16098034 GRCz11 23 15854111 - KASP Assay ID:
- 554-2956.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTATGTTTTTTTTTTTGTTATCAGGTCATCATTTTGAATCACCCAGGA[C/T]AGATCAGTTCAGGTTACTCTCCTGTCATAGACTGTCACACTGCTCATATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13094
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
ENSDART00000010119 | Nonsense | 352 | 463 | 7 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 16057497)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 16098034 GRCz11 23 15854111 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTATGTTTTTTTTTTTGTTATCAGGTCATCATTTTGAATCACCCAGGA[C/T]AGATCAGTTCAGGTTACTCTCCTGTCATAGACTGTCACACTGCTCATATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: