zgc:92085

Ensembl ID:
ENSDARG00000006838
ZFIN ID:
ZDB-GENE-040718-64
Description:
elongation factor 1-alpha 2 [Source:RefSeq peptide;Acc:NP_001002371]
Human Orthologue:
EEF1A2
Human Description:
eukaryotic translation elongation factor 1 alpha 2 [Source:HGNC Symbol;Acc:3192]
Mouse Orthologue:
Eef1a2
Mouse Description:
eukaryotic translation elongation factor 1 alpha 2 Gene [Source:MGI Symbol;Acc:MGI:1096317]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37650 Nonsense Mutation detected in F1 DNA During 2018
sa39401 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12662 Nonsense Available for shipment Available now
sa3224 Nonsense F2 line generated During 2018
sa13094 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010119 Nonsense 196 463 4 8
Genomic Location (Zv9):
Chromosome 23 (position 16064682)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16105219
GRCz11 23 15861296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATTGGTTATAGTCCAGCTTCCGTACCCTTTGTCCCTATTTCAGGCTG[G/A]CATGGCGACAACATGCTGGAACCGTCTTCCAATGTGAGTCTCCTTGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010119 Essential Splice Site 257 463 5 8
Genomic Location (Zv9):
Chromosome 23 (position 16064375)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16104912
GRCz11 23 15860989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGATAAACCCTTACGTCTTCCACTACAAGATGTCTACAAGATTGGAG[G/A]TGAGATCTAATGTTATTTAAAGAATTAGTTCACCCAAAATTTGTTAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010119 Nonsense 352 463 7 8
ENSDART00000010119 Nonsense 352 463 7 8
ENSDART00000010119 Nonsense 352 463 7 8
Genomic Location (Zv9):
Chromosome 23 (position 16057497)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16098034
GRCz11 23 15854111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATGTTTTTTTTTTTGTTATCAGGTCATCATTTTGAATCACCCAGGA[C/T]AGATCAGTTCAGGTTACTCTCCTGTCATAGACTGTCACACTGCTCATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3224
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010119 Nonsense 352 463 7 8
ENSDART00000010119 Nonsense 352 463 7 8
ENSDART00000010119 Nonsense 352 463 7 8
Genomic Location (Zv9):
Chromosome 23 (position 16057497)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16098034
GRCz11 23 15854111
KASP Assay ID:
554-2956.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATGTTTTTTTTTTTGTTATCAGGTCATCATTTTGAATCACCCAGGA[C/T]AGATCAGTTCAGGTTACTCTCCTGTCATAGACTGTCACACTGCTCATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010119 Nonsense 352 463 7 8
ENSDART00000010119 Nonsense 352 463 7 8
ENSDART00000010119 Nonsense 352 463 7 8
Genomic Location (Zv9):
Chromosome 23 (position 16057497)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16098034
GRCz11 23 15854111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATGTTTTTTTTTTTGTTATCAGGTCATCATTTTGAATCACCCAGGA[C/T]AGATCAGTTCAGGTTACTCTCCTGTCATAGACTGTCACACTGCTCATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link