
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cyr61l2
- Ensembl ID:
- ENSDARG00000006823
- ZFIN ID:
- ZDB-GENE-060404-5
- Description:
- cysteine-rich, angiogenic inducer, 61 [Source:RefSeq peptide;Acc:NP_001074456]
- Human Orthologue:
- CYR61
- Human Description:
- cysteine-rich, angiogenic inducer, 61 [Source:HGNC Symbol;Acc:2654]
- Mouse Orthologue:
- Cyr61
- Mouse Description:
- cysteine rich protein 61 Gene [Source:MGI Symbol;Acc:MGI:88613]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34520 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa41310 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34520
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098226 | Nonsense | 14 | 373 | 1 | 6 |
ENSDART00000124857 | Nonsense | 14 | 373 | 1 | 5 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 55072027)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 52633317 GRCz11 8 52619610 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCTTGGAAATGCATTCTGGAAGAAATCAGAGGACGCGGACACACACTTG[G/A]GTTGTTTTGTTGTTCGTGGTTTGCTCTGCTGACGGAGAGGTGAGGAGATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41310
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098226 | Nonsense | 165 | 373 | 3 | 6 |
ENSDART00000124857 | Nonsense | 165 | 373 | 3 | 5 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 55066904)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 52638440 GRCz11 8 52624733 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCACACTGCACCAATCCTCGGCTGGAGACGCCGACTGGGCACTGCTGC[C/T]AGCGCTGGGTGTGTGACAGCGACAACAGCATCAGAGAGGAGGAGCCGCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: