snd1

Ensembl ID:
ENSDARG00000006766
ZFIN ID:
ZDB-GENE-030131-3124
Description:
Staphylococcal nuclease domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZT42]
Human Orthologue:
SND1
Human Description:
staphylococcal nuclease and tudor domain containing 1 [Source:HGNC Symbol;Acc:30646]
Mouse Orthologue:
Snd1
Mouse Description:
staphylococcal nuclease and tudor domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1929266]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33454 Nonsense Mutation detected in F1 DNA During 2018
sa10166 Nonsense Available for shipment Available now
sa20260 Nonsense Available for shipment Available now
sa26284 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6940 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20259 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040405 Nonsense 47 913 2 24
ENSDART00000090972 Nonsense 47 911 2 26
ENSDART00000100974 Nonsense 47 574 2 15
Genomic Location (Zv9):
Chromosome 4 (position 18624850)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19701456
GRCz11 4 19690432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTGCTATCATTGTTCGAGGTCAGCCACGAGGTGGACCTCCTCCAGAA[C/T]GACAGATCAACCTGAGTAACATAAGAGCCGGAGCTCTAGCCCGTCGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040405 Nonsense 178 913 5 24
ENSDART00000090972 Nonsense 178 911 5 26
ENSDART00000100974 Nonsense 178 574 5 15
Genomic Location (Zv9):
Chromosome 4 (position 18616050)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19692656
GRCz11 4 19681632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGGGCCTGTGGTCTGAGGGTGGAGGCTCGCACACCATTCGAGATCTC[A/T]AGTACACCATCGAGAACCCTCGCAAMTTYGTGGACTCCCTGCATCARAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040405 Nonsense 327 913 9 24
ENSDART00000090972 Nonsense 327 911 9 26
ENSDART00000100974 Nonsense 327 574 9 15
Genomic Location (Zv9):
Chromosome 4 (position 18599433)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19676039
GRCz11 4 19665015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTCTTTAAAACCCTGCAGATCAGCAAAAGAGCGTAAAGTGAGAATTT[G/A]GAAGGACTATGTTGCTCCCACAGCCAATCTGGACCAGAAGGACAGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040405 Essential Splice Site 512 913 14 24
ENSDART00000090972 Essential Splice Site 512 911 14 26
ENSDART00000100974 Essential Splice Site 512 574 14 15
Genomic Location (Zv9):
Chromosome 4 (position 18542708)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19619314
GRCz11 4 19608290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAGCAAGAAAGAAGTGCCCATTCATAGAGTGGCGGACATTTCAGGG[G/A]TAAGTGGGTGTTGGGAATAACTAATCCTACATTGGATTTTTGTTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040405 Essential Splice Site 877 913 22 24
ENSDART00000090972 Essential Splice Site 875 911 24 26
ENSDART00000100974   None 574 None 15
Genomic Location (Zv9):
Chromosome 4 (position 18349138)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19425744
GRCz11 4 19414720
KASP Assay ID:
554-4965.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCATGGTCATGGTGGACATCCGGAAAGARAAGTACCTCCAGAAAATGG[T/A]GAGTCAAGAGTTCAAATAGGGAGCGTKGAGTGANNNNNNNGCTAGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040405 Essential Splice Site 892 913 23 24
ENSDART00000090972 Essential Splice Site 890 911 25 26
ENSDART00000100974   None 574 None 15
Genomic Location (Zv9):
Chromosome 4 (position 18336236)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19412842
GRCz11 4 19401818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGGTGACTGAATATCTGAATGCCCAGGAATCTGCCAAGAGCGCCAGG[G/A]TAAGATCTGCAGTTTTAAGTTCTTGATTCATATATATGTCTGTTGCTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Genome-wide association study in a Chinese population identifies a susceptibility locus for type 2 diabetes at 7q32 near PAX4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link