wu:fc39c11

Ensembl ID:
ENSDARG00000006754
ZFIN IDs:
ZDB-GENE-030131-3440, ZDB-GENE-030131-3440, ZDB-GENE-050417-356
Description:
protein AF-9 [Source:RefSeq peptide;Acc:NP_001017819]
Human Orthologue:
MLLT3
Human Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 [Sour
Mouse Orthologue:
Mllt3
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 Gene

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31559 Nonsense Available for shipment Available now
sa13570 Nonsense Available for shipment Available now
sa34031 Nonsense Available for shipment Available now
sa14211 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021502 Nonsense 58 555 3 13
ENSDART00000053278 Nonsense 90 587 3 13
ENSDART00000054998 Nonsense 90 269 3 8
ENSDART00000113593 Nonsense 26 523 1 11

The following transcripts of ENSDARG00000006754 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 20042131)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18575160
GRCz11 7 18827427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAGAGTCTGGATACGCTGGCTTTATCTTGCCTATTGAAGTTTACTTT[A/T]AAAATAAGGTATTGTTTTTCCTCTCTTGTGGATTATTGCCTGTATAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021502 Nonsense 314 555 7 13
ENSDART00000053278 Nonsense 346 587 7 13
ENSDART00000054998   None 269 None 8
ENSDART00000113593 Nonsense 282 523 5 11

The following transcripts of ENSDARG00000006754 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 20025485)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18558514
GRCz11 7 18810781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCCTGCCCTGCTGCAGCAGCAGCACCATMATTCKGATAAAAAGGTTT[T/A]GAAAGACAAGCCDCAGATCCGGCATAATCGATTACAAAACAGTGAACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021502 Nonsense 346 555 7 13
ENSDART00000053278 Nonsense 378 587 7 13
ENSDART00000054998   None 269 None 8
ENSDART00000113593 Nonsense 314 523 5 11

The following transcripts of ENSDARG00000006754 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 20025389)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18558418
GRCz11 7 18810685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTCAGAGAAGAAAAAGCTGCAAGCATTACCGCCCTTCCAGAATGTGT[T/A]GGACCCCAATGACTCTGATATGGATGACAACACCTTCACAAGATCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021502 Essential Splice Site 466 555 10 13
ENSDART00000053278 Essential Splice Site 498 587 10 13
ENSDART00000054998   None 269 None 8
ENSDART00000113593 Essential Splice Site 434 523 8 11

The following transcripts of ENSDARG00000006754 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 20004391)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18537420
GRCz11 7 18789687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTACYCCATAATGATCCTCCGCCGTTGCTGAAAAACAGCARTAACCAG[G/A]TGAGCTGCAGTCGCCTTCTGTCYCATTCAGTCCACAGGTGAGGATTTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link