
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ripk1l
- Ensembl ID:
- ENSDARG00000006677
- ZFIN ID:
- ZDB-GENE-070705-132
- Description:
- receptor-interacting serine/threonine-protein kinase 1 [Source:RefSeq peptide;Acc:NP_001036815]
- Human Orthologue:
- RIPK1
- Human Description:
- receptor (TNFRSF)-interacting serine-threonine kinase 1 [Source:HGNC Symbol;Acc:10019]
- Mouse Orthologue:
- Ripk1
- Mouse Description:
- receptor (TNFRSF)-interacting serine-threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:108212]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5116 | Nonsense | F2 line generated | During 2018 |
sa39740 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5116
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024967 | Nonsense | 23 | 661 | 1 | 10 |
ENSDART00000109397 | Nonsense | 23 | 675 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 2 (position 1089597)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 1035418 GRCz11 2 905826 - KASP Assay ID:
- 554-3563.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCGAGTCTCATGAAATCAGCAGATCTGATCAAGAAAGAGCCTCTGGATTA[T/A]GGAGGATTTGGAGAAGTTTACTTGTGTTACCATAAAACTCTTGGACATGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39740
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024967 | Nonsense | 31 | 661 | 1 | 10 |
ENSDART00000109397 | Nonsense | 31 | 675 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 2 (position 1089620)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 1035441 GRCz11 2 905849 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGATCAAGAAAGAGCCTCTGGATTATGGAGGATTTGGAGAAGTTTACT[T/A]GTGTTACCATAAAACTCTTGGACATGTGGTGCTAAAGACCGTCTACACCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: