znf395

Ensembl ID:
ENSDARG00000006672
ZFIN ID:
ZDB-GENE-031002-50
Description:
zinc finger protein 395 [Source:RefSeq peptide;Acc:NP_956402]
Human Orthologue:
FAM49A
Human Description:
family with sequence similarity 49, member A [Source:HGNC Symbol;Acc:25373]
Mouse Orthologue:
Fam49a
Mouse Description:
family with sequence similarity 49, member A Gene [Source:MGI Symbol;Acc:MGI:1261783]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29414 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002773 Nonsense 133 323 6 12
ENSDART00000137915 Nonsense 134 324 6 12

The following transcripts of ENSDARG00000006672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 35317618)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35390131
GRCz11 20 35293010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCACTCAGCACCTGGAGAGAGAGCAGGCCCTCGCTAAACAGTTTGCT[G/T]AAATCCTGCATTTCACCCTCCGCTTTGATGAGCTTAAGGTATCGGAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link