si:dkeyp-69c1.6

Ensembl ID:
ENSDARG00000006666
ZFIN ID:
ZDB-GENE-030131-6333
Description:
Wu:fi47e11 protein [Source:UniProtKB/TrEMBL;Acc:Q4KMD1]
Human Orthologue:
BUD13
Human Description:
BUD13 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28199]
Mouse Orthologue:
Bud13
Mouse Description:
BUD13 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2443443]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1513 Nonsense Available for shipment Available now
sa23927 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065544 Nonsense 435 518 9 11
Genomic Location (Zv9):
Chromosome 21 (position 21817817)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22666230
GRCz11 21 22702835
KASP Assay ID:
554-1437.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTAGCGAGACACATTGACGATGAAGACCTYGATCGCATGCTAAGAGAG[C/T]AAGAGAGAGAAGGAGACCCAATGGCGGCAATGCTTCGCAAGAAGAAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065544 Nonsense 516 518 11 11
Genomic Location (Zv9):
Chromosome 21 (position 21820112)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22668525
GRCz11 21 22705130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGGCCGATAACAAAGCTGTCCAAGAGATGGCGTACAAGTGGAGTGTT[G/T]AAGACATGTAGATGTTCCTAAAGATGCAGATTTGGGTACAGAGAATGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link