
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sc:d0319
- Ensembl ID:
- ENSDARG00000006636
- ZFIN ID:
- ZDB-GENE-080327-7
- Description:
- cDNA, clone cssl:d0319 [Source:UniProtKB/TrEMBL;Acc:A8BAV3]
- Human Orthologue:
- SLITRK2
- Human Description:
- SLIT and NTRK-like family, member 2 [Source:HGNC Symbol;Acc:13449]
- Mouse Orthologue:
- Slitrk2
- Mouse Description:
- SLIT and NTRK-like family, member 2 Gene [Source:MGI Symbol;Acc:MGI:2679449]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19079 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11011 | Nonsense | Available for shipment | Available now |
sa15552 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19079
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005738 | Nonsense | 64 | 854 | 1 | 1 |
ENSDART00000005738 | Nonsense | 64 | 854 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 14 (position 20275155)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 18957444 GRCz11 14 19258891 - KASP Assay ID:
- 2260-7452.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAAAACAAGGCTTTTACCACGGTCAGCCTGTTCCAGCCTCCGCAAAAC[A/T]AAATCAGTCAGCTCTTTCTGAATGGAAACTTTCTCACCAAGATAAGCCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11011
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005738 | Nonsense | 64 | 854 | 1 | 1 |
ENSDART00000005738 | Nonsense | 64 | 854 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 14 (position 20275155)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 18957444 GRCz11 14 19258891 - KASP Assay ID:
- 2260-7452.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGAAAACAAGGCTTTTACCACGGTCAGCCTGTTCCAGCCTCCGCAAAAC[A/T]AAATCAGTCAGCTCTTTCTGAATGGAAACTTTCTCACCAAGATAAGCCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15552
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005738 | Nonsense | 334 | 854 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 14 (position 20275965)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 18958254 GRCz11 14 19259701 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGTCACGTCTAGCAGAGATAAACACGTATTCGGGCCTATCATGGTGTAT[C/T]AGACGCGCTCGCCAGTCCCAATGACCTGTCCGGGCATTTGCGTGTGCACG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: