
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
irf4a
- Ensembl ID:
- ENSDARG00000006560
- ZFIN ID:
- ZDB-GENE-070912-330
- Description:
- interferon regulatory factor 4 [Source:RefSeq peptide;Acc:NP_001116182]
- Human Orthologue:
- IRF4
- Human Description:
- interferon regulatory factor 4 [Source:HGNC Symbol;Acc:6119]
- Mouse Orthologue:
- Irf4
- Mouse Description:
- interferon regulatory factor 4 Gene [Source:MGI Symbol;Acc:MGI:1096873]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12189 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12189
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019733 | Nonsense | 20 | 460 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 1063514)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 1009335 GRCz11 2 879743 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAGATGGGGACTGCATCATGTCAGTCAGTTGTGGGAATGGCAAACTTAGA[C/T]AGTGGCTCATCGAGCAGATTGACAGCGGGGAGTATTCCGGATTGGTTTGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Black vs. red hair color: A genome-wide association study identifies novel alleles associated with hair color and skin pigmentation. (View Study)
- Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
- Chronic lymphocytic leukemia: A genome-wide association study identifies six susceptibility loci for chronic lymphocytic leukemia. (View Study)
- Hair color: Web-based, participant-driven studies yield novel genetic associations for common traits. (View Study)
- Hematology traits: Genome-wide association study of serum albumin:globulin ratio in Korean populations. (View Study)
- Progressive supranuclear palsy: Identification of common variants influencing risk of the tauopathy progressive supranuclear palsy. (View Study)
- Skin sensitivity to sun: Genetic determinants of hair, eye and skin pigmentation in Europeans. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: