supt6h

Ensembl ID:
ENSDARG00000006524
ZFIN ID:
ZDB-GENE-030131-7949
Description:
Transcription elongation factor SPT6 [Source:UniProtKB/Swiss-Prot;Acc:Q8UVK2]
Human Orthologue:
SUPT6H
Human Description:
suppressor of Ty 6 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:11470]
Mouse Orthologue:
Supt6h
Mouse Description:
suppressor of Ty 6 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:107726]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23947 Essential Splice Site Available for shipment Available now
sa16191 Nonsense Available for shipment Available now
sa16076 Nonsense Available for shipment Available now
sa37322 Nonsense Available for shipment Available now
sa37323 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028007 Essential Splice Site 488 1726 13 37
Genomic Location (Zv9):
Chromosome 21 (position 25429039)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25998857
GRCz11 21 26035552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTTTATTAATGCATTACACCAAAACCTTTTGTGTGTTTTTATTTCC[A/T]GGGGAAGAAGCAGAAGTGGAGGAGGAAGAGGAAGAAGAGGAGCAAAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028007 Nonsense 600 1726 15 37
ENSDART00000028007 Nonsense 600 1726 15 37
Genomic Location (Zv9):
Chromosome 21 (position 25429748)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25999566
GRCz11 21 26036261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGCCATGCAGATTGCCCGCGAGCCTCTGGTCAGACACGTGCTCAGA[C/T]AAACCTTCCAGGAGAGGGCCAAGATTAACATCAAGCCAACTAAGAAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028007 Nonsense 600 1726 15 37
ENSDART00000028007 Nonsense 600 1726 15 37
Genomic Location (Zv9):
Chromosome 21 (position 25429748)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25999566
GRCz11 21 26036261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGCCATGCAGATTGCCCGCGAGCCTCTGGTCAGACACGTGCTCAGA[C/T]AAACCTTCCAGGAGAGGGCCAAGATTAACATCAAGCCAACTAAGAAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028007 Nonsense 632 1726 16 37
Genomic Location (Zv9):
Chromosome 21 (position 25431538)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26001356
GRCz11 21 26038051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTCCAGGATGTGGATGAGGCGCACTTTGCCTATTCTTTCAAGTACT[T/A]GAAGAACAAGCCTGTGAAAGAGCTCAGTGGAGATCAGTTCTTGAAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028007 Nonsense 1115 1726 26 37
Genomic Location (Zv9):
Chromosome 21 (position 25443045)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26012863
GRCz11 21 26049558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTTTCTATCTTTTTTAGGGTTATGGTAATAAGGGAATTACACTGTA[T/G]GACATCCGAGCAGAGCTCAGCTGTAGATATAAAGACCTGAGAGCTCCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link