zgc:92316

Ensembl ID:
ENSDARG00000006508
ZFIN ID:
ZDB-GENE-040912-141
Description:
phosphatidylinositol-4-phosphate 5-kinase type-1 beta [Source:RefSeq peptide;Acc:NP_001004579]
Human Orthologue:
PIP5K1B
Human Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, beta [Source:HGNC Symbol;Acc:8995]
Mouse Orthologue:
Pip5k1b
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase, type 1 beta Gene [Source:MGI Symbol;Acc:MGI:107930]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7122 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41132 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13090 Nonsense Available for shipment Available now
sa21206 Nonsense Available for shipment Available now
sa34316 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008215 Essential Splice Site None 527 2 15
Genomic Location (Zv9):
Chromosome 8 (position 11417647)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11251477
GRCz11 8 11289182
KASP Assay ID:
554-4906.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCAGCGCTGAACCAAACACCAACACCTGTGCTCTTGGTTAAATCAAG[G/A]TAAACCATAATTGCATMATWTATTATTAACAGAACCRCACATTTGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008215 Essential Splice Site 106 527 5 15
Genomic Location (Zv9):
Chromosome 8 (position 11428258)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11240866
GRCz11 8 11278571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCGCTACTTCCGGGAGCTGTTCGGGATCAAGCCGGATGATTATTTGG[T/G]AAACTTTTTTAAATTTGTTGTTGTTATTAGTATATTTATTCTTTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008215 Nonsense 225 527 7 15
Genomic Location (Zv9):
Chromosome 8 (position 11439383)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11229741
GRCz11 8 11267446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAGAGACGKGCGTCAYGAAAAGAGCGGGAAAAGCCCTGTCCCACATA[T/G]AAGGACCTAGACTTWGTGGACATGCATGATGGYTTGYACTTTGACCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008215 Nonsense 266 527 8 15
Genomic Location (Zv9):
Chromosome 8 (position 11456011)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11213113
GRCz11 8 11250818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTAAAATGTGCTGTAGGTGCTGGAGAGTTTTAAGATCATGGACTA[C/A]AGTCTCCTGCTGGGGGTTCATGTTCTGGATCAGAGTCACAGAGATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008215 Essential Splice Site 394 527 11 15
Genomic Location (Zv9):
Chromosome 8 (position 11457849)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11211275
GRCz11 8 11248980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGATTTCTCAAGTTCATGAGCAGCCGAGTGTTCAGAAAGAATCAGCG[T/G]AAGTCTACAATATGAAGATGCATTTTTGATGCAGATGCAACATTACATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link