zgc:136371

Ensembl ID:
ENSDARG00000006501
ZFIN IDs:
ZDB-GENE-030131-1239, ZDB-GENE-060818-12
Description:
cytochrome P450 like [Source:RefSeq peptide;Acc:NP_001037774]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052054 Nonsense 446 509 9 9
ENSDART00000052055   414 413 10 10
ENSDART00000142042   None 312 None 6
ENSDART00000145645   418 417 10 10
Genomic Location (Zv9):
Chromosome 7 (position 53406119)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51675869
GRCz11 7 51950939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCATGATGTCCACTTTCTTTCCAATTTCCTAGGACCTCGTGTTTGTT[T/A]AGGAGAAAATCTAGCCCGCATGGAGCTCTTCCTCATCCTGGTCACTGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link