rtn1a

Ensembl ID:
ENSDARG00000006497
ZFIN ID:
ZDB-GENE-030131-2426
Description:
reticulon-1 isoform 1 [Source:RefSeq peptide;Acc:NP_001025138]
Human Orthologue:
RTN1
Human Description:
reticulon 1 [Source:HGNC Symbol;Acc:10467]
Mouse Orthologue:
Rtn1
Mouse Description:
reticulon 1 Gene [Source:MGI Symbol;Acc:MGI:1933947]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42233 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13604 Essential Splice Site Available for shipment Available now
sa45491 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441   None 165 None 8
ENSDART00000057445 Essential Splice Site 62 249 1 7
ENSDART00000076548 Essential Splice Site 62 157 1 8
ENSDART00000076571   None 203 None 7
ENSDART00000076574 Essential Splice Site 62 818 1 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31693669)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31339617
GRCz11 13 31470067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCATCCCTTTGAAGGAACCGGCGTTGCCATGGAAACTGCATCTACAG[G/A]TAAATTTGGGCTTTTTATAAATGGCCATTGTGTGTTTTAGCGACGACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 Essential Splice Site 17 165 2 8
ENSDART00000057445 Essential Splice Site 63 249 2 7
ENSDART00000076548   None 157 None 8
ENSDART00000076571 Essential Splice Site 17 203 2 7
ENSDART00000076574 Essential Splice Site 632 818 4 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31653142)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31299090
GRCz11 13 31429540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAATTATGTTCATGTTCTTCTCTCTCTTTCTSTCYGTCTTTCTCCWCA[G/A]TGGTAGATCKAGTACACTGGCGGGATCTKAAGCAGTCTGGACTGGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441   None 165 None 8
ENSDART00000057445   107 249 2 7
ENSDART00000076548 Essential Splice Site 105 157 None 8
ENSDART00000076571   61 203 2 7
ENSDART00000076574   676 818 4 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31653008)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31298956
GRCz11 13 31429406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTCAGTGTGGTGAGTGTTATAGCGTATCTGGCTCTGGCTGTCCTCTC[T/C]GCTACCATCAGCTTCCGAGTCTACAAATCAGTCCTGCAGGCAGTGCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link