zgc:123250

Ensembl ID:
ENSDARG00000006474
ZFIN ID:
ZDB-GENE-051127-27
Description:
hypothetical protein LOC641580 [Source:RefSeq peptide;Acc:NP_001032667]
Human Orthologues:
AC027807.2, FAM154B
Human Description:
family with sequence similarity 154, member B [Source:HGNC Symbol;Acc:33727]
Mouse Orthologue:
Fam154b
Mouse Description:
family with sequence similarity 154, member B Gene [Source:MGI Symbol;Acc:MGI:1914618]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14286 Nonsense Available for shipment Available now
sa9824 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053860 Nonsense 7 465 1 4
Genomic Location (Zv9):
Chromosome 7 (position 13190090)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 12118204
GRCz11 7 12371165
GRCz11 KZ115966.1 418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACATTCATAATWATCKTCAATAAACCGAYGAAAATGACACGCCTTTG[T/A]ATCTGTGAGATGTGCAGCTGTGGGTAAGAGAGTGTTTGATTTGTTGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053860 Nonsense 47 465 2 4
Genomic Location (Zv9):
Chromosome 7 (position 13191926)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 12120040
GRCz11 7 12373001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTCAGACCAACGTGTTGTCAGAGTACAYAGAGAAGTATCCTCCCTAY[A/T]AAGGTCACACTCGTCCCAAGAGCCTCAAGCCCCAACTGAAGTAYAAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link