si:dkey-240a12.1

Ensembl ID:
ENSDARG00000006396
ZFIN ID:
ZDB-GENE-041210-235
Description:
neuronal cell adhesion molecule [Source:RefSeq peptide;Acc:NP_001038270]
Human Orthologue:
NRCAM
Human Description:
neuronal cell adhesion molecule [Source:HGNC Symbol;Acc:7994]
Mouse Orthologue:
Nrcam
Mouse Description:
neuron-glia-CAM-related cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:104750]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18780 Nonsense Mutation detected in F1 DNA During 2018
sa9843 Nonsense Available for shipment Available now
sa20238 Nonsense Available for shipment Available now
sa44586 Nonsense Mutation detected in F1 DNA During 2018
sa14699 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007237 Nonsense 231 1294 6 29
ENSDART00000109195 Nonsense 225 1292 5 29
ENSDART00000110370 Nonsense 225 1292 5 29
ENSDART00000122041 Nonsense 225 1285 5 28
ENSDART00000007237 Nonsense 231 1294 6 29
ENSDART00000109195 Nonsense 225 1292 5 29
ENSDART00000110370 Nonsense 225 1292 5 29
ENSDART00000122041 Nonsense 225 1285 5 28
Genomic Location (Zv9):
Chromosome 4 (position 12767643)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13704270
GRCz11 4 13703119
KASP Assay ID:
2259-4684.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACATCTGCTACGCCCGCTTCCCACACACTCAGACTATCCAACAGAAA[C/T]AGCCCATCACCGTCAAAGTGCTGGACAGTAAGTGTTGTTAGACTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007237 Nonsense 231 1294 6 29
ENSDART00000109195 Nonsense 225 1292 5 29
ENSDART00000110370 Nonsense 225 1292 5 29
ENSDART00000122041 Nonsense 225 1285 5 28
ENSDART00000007237 Nonsense 231 1294 6 29
ENSDART00000109195 Nonsense 225 1292 5 29
ENSDART00000110370 Nonsense 225 1292 5 29
ENSDART00000122041 Nonsense 225 1285 5 28
Genomic Location (Zv9):
Chromosome 4 (position 12767643)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13704270
GRCz11 4 13703119
KASP Assay ID:
2259-4684.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTACATCTGCTACGCCCGCTTCCCACACACTCAGACTATCCAACAGAAA[C/T]AGYCCATCACCGTCAAAGTGCTGGACAGTAAGTGYTGTTAGACWGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007237 Nonsense 957 1294 21 29
ENSDART00000109195 Nonsense 951 1292 20 29
ENSDART00000110370 Nonsense 951 1292 20 29
ENSDART00000122041 Nonsense 971 1285 21 28
Genomic Location (Zv9):
Chromosome 4 (position 12779300)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13715927
GRCz11 4 13714776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCACCTTTGGAAGACAACGGACACTTGACTGGATACTTGTTGAAATA[T/A]CAGCCAAGTAGGTTAAAGTTAGAGCTTTTTTTAATTCAAATTTGTTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007237 Nonsense 1049 1294 24 29
ENSDART00000109195 Nonsense 1043 1292 23 29
ENSDART00000110370 Nonsense 1043 1292 23 29
ENSDART00000122041   None 1285 None 28
Genomic Location (Zv9):
Chromosome 4 (position 12784886)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13721513
GRCz11 4 13720362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCCCCCCTTCACCACCACCACCAACTCCCCCTGTCACTCAATCTTTG[C/T]AGCCCCCGTTTCAGGGTACAAGCATCTGCCGTCTCGTCACCTTTTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007237 Splice Site, Nonsense 1096 1294 26 29
ENSDART00000109195 Splice Site, Nonsense 1090 1292 25 29
ENSDART00000110370 Splice Site, Nonsense 1090 1292 25 29
ENSDART00000122041 Splice Site, Nonsense 1087 1285 25 28
Genomic Location (Zv9):
Chromosome 4 (position 12787110)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13723737
GRCz11 4 13722586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGTTTTTGCCATAATCTCTCCCCTGCCGTCGGCCCTTTTCTCCAGGT[A/T]AAGAACCCTGGAAAACCGAGTTTGTAAATGGCACTCGGACATTTCAGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link