zgc:158267

Ensembl ID:
ENSDARG00000006385
ZFIN ID:
ZDB-GENE-061215-80
Description:
hypothetical protein LOC790927 [Source:RefSeq peptide;Acc:NP_001073541]
Human Orthologue:
TRIOBP
Human Description:
TRIO and F-actin binding protein [Source:HGNC Symbol;Acc:17009]
Mouse Orthologue:
Triobp
Mouse Description:
TRIO and F-actin binding protein Gene [Source:MGI Symbol;Acc:MGI:1349410]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031823 Nonsense 181 504 5 12
Genomic Location (Zv9):
Chromosome 3 (position 1949017)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1407229
GRCz11 3 1175878
KASP Assay ID:
554-0709.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTAATCAAAGGGAGTCAGGGGAGGGGCAGGTGAAGGAGCACAGCCAATG[G/A]CAGGAGACACGGCCTTCTGACGRCGCCCACAACCAGTGGGAGGCGGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link