
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ugt5c2
- Ensembl ID:
- ENSDARG00000006372
- ZFIN ID:
- ZDB-GENE-060825-206
- Description:
- UDP glucuronosyltransferase 5 family, polypeptide C2 [Source:RefSeq peptide;Acc:NP_001038851]
- Human Orthologue:
- UGT8
- Human Description:
- UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
- Mouse Orthologue:
- Ugt8a
- Mouse Description:
- UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36708 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14335 | Nonsense | Available for shipment | Available now |
sa36709 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36708
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087645 | Nonsense | 137 | 552 | 2 | 2 |
ENSDART00000087647 | Nonsense | 116 | 531 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 18 (position 38765156)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40477873 GRCz11 18 40468065 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAATACGAAAAAGAAAAAGGCTCCTGGCTGAGTATTGTAAGGCTGTATT[T/A]AAATGTGTTTGATGCTGTCAAAAAAACTCATGAAATGGTGTGTCAGCTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14335
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087645 | Nonsense | 425 | 552 | 2 | 2 |
ENSDART00000087647 | Nonsense | 404 | 531 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 18 (position 38766021)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40478738 GRCz11 18 40468930 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTACCATGGTGTTCCAGTGATTGGAATYCCATTCTTTTTTGACCAGTA[T/G]GACAATCTCATTCGAYTACAAGCAAGAGGTGGAGCCAAGTTGCTTTCCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36709
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087645 | Nonsense | 438 | 552 | 2 | 2 |
ENSDART00000087647 | Nonsense | 417 | 531 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 18 (position 38766058)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40478775 GRCz11 18 40468967 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTTGACCAGTATGACAATCTCATTCGATTACAAGCAAGAGGTGGAGCC[A/T]AGTTGCTTTCCATTGCAGATCTAGGTGAAAACACACTGCATGCAGCAATA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: