slc18a3a

Ensembl ID:
ENSDARG00000006356
ZFIN ID:
ZDB-GENE-060929-990
Description:
Probable vesicular acetylcholine transporter-A [Source:UniProtKB/Swiss-Prot;Acc:Q08C75]
Human Orthologue:
SLC18A3
Human Description:
solute carrier family 18 (vesicular acetylcholine), member 3 [Source:HGNC Symbol;Acc:10936]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16779 Nonsense Available for shipment Available now
sa42217 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026765 Nonsense 16 513 1 1
Genomic Location (Zv9):
Chromosome 13 (position 29647696)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29293644
GRCz11 13 29424094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCATGGCTACGGAGGAATCAGGTGGCTTGGCGCAAACCGYCGCCGTT[A/T]AACTTTCGGAGATGGGGGAAAGAACTAAACAGTTAGGAAATGCGATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026765 Nonsense 296 513 1 1
Genomic Location (Zv9):
Chromosome 13 (position 29646854)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29292802
GRCz11 13 29423252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCCACCATCGCAAACTGGATGGAAGAGACCATGAATGCATCCCAATG[G/A]CAGATCGGGATCACCTGGCTGCCAGCCTTCTTCCCTCACATATTAGGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link