snx14

Ensembl ID:
ENSDARG00000006332
ZFIN ID:
ZDB-GENE-040724-144
Description:
sorting nexin-14 [Source:RefSeq peptide;Acc:NP_001038258]
Human Orthologue:
SNX14
Human Description:
sorting nexin 14 [Source:HGNC Symbol;Acc:14977]
Mouse Orthologue:
Snx14
Mouse Description:
sorting nexin 14 Gene [Source:MGI Symbol;Acc:MGI:2155664]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23619 Nonsense Available for shipment Available now
sa18413 Nonsense Available for shipment Available now
sa29287 Essential Splice Site Mutation detected in F1 DNA During 2018
sa914 Essential Splice Site Available for shipment Available now
sa16606 Nonsense Available for shipment Available now
sa23618 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020506 Nonsense 27 934 2 29
ENSDART00000104725 Nonsense 27 936 2 30
ENSDART00000141333   None 179 None 6
ENSDART00000142361 Nonsense 27 936 2 29
Genomic Location (Zv9):
Chromosome 20 (position 915323)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 871188
GRCz11 20 892014
KASP Assay ID:
2261-3840.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGGAGGGGTCTGCGCTTCGACATGTTTAAGGATGTTGCTCGTCAATA[T/G]CCGGTCATCTTCTGCATCTTCACGGTTATGATCTCCTCCACCATCATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020506 Nonsense 55 934 3 29
ENSDART00000104725 Nonsense 55 936 3 30
ENSDART00000141333   None 179 None 6
ENSDART00000142361 Nonsense 55 936 3 29
Genomic Location (Zv9):
Chromosome 20 (position 914680)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 870545
GRCz11 20 891371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATATCCTCMCRCTTTCTGCAGGTATCTCCATAKTCTRATGGTTTTYTG[G/A]TCATTTCTGGCTGGAGTGATCACGTTTTACTGCTCCCTCAGCCCAGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020506 Essential Splice Site 153 934 6 29
ENSDART00000104725 Essential Splice Site 153 936 6 30
ENSDART00000141333 Essential Splice Site 34 179 2 6
ENSDART00000142361 Essential Splice Site 153 936 6 29
Genomic Location (Zv9):
Chromosome 20 (position 907978)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 863843
GRCz11 20 884669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGTGTTGGAGTTAGTCCTAGAGAACTTTGTGTATCCGTGGTACAGG[T/A]ATGGCGGATTTAAAACGTTCACTATTGTTGACTATCAGCTGGAAAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020506 Essential Splice Site 482 934 16 29
ENSDART00000104725 Essential Splice Site 482 936 16 30
ENSDART00000141333   None 179 None 6
ENSDART00000142361 Essential Splice Site 482 936 16 29
Genomic Location (Zv9):
Chromosome 20 (position 898080)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 853945
GRCz11 20 874771
KASP Assay ID:
554-0820.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGCTCTGCGGCGCCGAGTCTCCAGCTAGAAATTCAAAGCTCAACAGG[T/C]GAGCCTCTTCCACWTGTATGTAGAGTCGGGGGGAAAAGCTGCAACACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020506 Nonsense 585 934 18 29
ENSDART00000104725 Nonsense 585 936 18 30
ENSDART00000141333   None 179 None 6
ENSDART00000142361 Nonsense 585 936 18 29
Genomic Location (Zv9):
Chromosome 20 (position 887248)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 843113
GRCz11 20 863939
KASP Assay ID:
2261-3837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATKATGAGGTTAAGAAAGAGCGTATTCCAGTCTTCTGCATCGACGTGGAG[C/T]GAAACGATAGGAAAAACGGTGAGTTTCTGAAACGTACATYCACTCCAARC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020506 Essential Splice Site 703 934 22 29
ENSDART00000104725 Essential Splice Site 703 936 22 30
ENSDART00000141333   None 179 None 6
ENSDART00000142361 Essential Splice Site 703 936 22 29
Genomic Location (Zv9):
Chromosome 20 (position 881444)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 837309
GRCz11 20 858135
KASP Assay ID:
2261-3836.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTACAGGAAAAATATTCAAGTCAGTGCCAGGAAAACTAATCAAAGAG[G/A]TAAGAGTTAGAATTGCATTGTTCGTGTGTATTTCACCTCTGTGCTCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link